Questions: Answer concisely Q1) Draw and label a standard growth


Question Description:

35

Questions: Answer concisely Q1) Draw and label a standard growth curve. Describe each of the 4 phases. Why do you think bacteria do not continue to double indefinitely? You sample a culture that has reached the fourth phase after 2 days, can you think of one reason why the culture would begin to increase on day 4? Q2) Imagine NASA sends you a specimen from a planet that they believe contains an extraterrestrial bacterial species. You are the microbiologist in charge of determining how to grow the extraterrestrial bacteria. Many factors may affect the growth of extraterrestrial bacteria. Choose two and describe how you would test their effects. Q3) RNA plays several important roles in the processes that express genetic information from DNA into protein products. Illustrate the events of transcription in a bacterial cell and indicate where RNA plays a role. Also indicate what role RNA plays in translation in bacterial cells. Q4. Define: Replication, Transcription, Translation, Mutation, DNA, RNA, Selective media, Differential media, Chromosome, tRNA, rRNA. Q5. Define the following terms: Replication, Transcription, Translation, Mutation, DNA, RNA, Selective media, Differential media, Chromosome, tRNA, rRNA, lagging strand, leading strand, Ribosomes, genetic code, codon, anticodon, polysomes, polycistronic mRNA, Introns, exons, mutation, thymine dimer, plasmid, operon, Q6. Identify and explain the events of the three phases of DNA replication. Q7. Compare and contrast spontaneous and induced mutations, and differentiate between physical and chemical mutagens. Q8. The following base sequence is a complete polynucleotide made in bacterial cell. AUGGCGAUAGUUAAACCCGGAGGGUGA With this sequence, answer the following questions. Provide the nucleotide bases found in the inactive DNA strand of the gene. How many codons will be transcribed in the mRNA made from the template DNA strand? How many amino acids are coded by the mRNA made and what are the specific amino acids? Why isn’t the number of codons in the template DNA the same as the number of amino acids in the polypeptide? Q9. Use the base sequence to answer the following questions about mutations. TACACGATGGTTTTGAAGTTACGTATT Is the sequence above a single strand of DNA or RNA? Why?Using the sequence above, show the translation result if a mutation results in a C replacing T at base 12 from the left end of the sequence. Is this an example of silent, missense, or nonsense mutation? Q10. Reflect on how homework assignments helped you learn the material during this course.

Answer

35