QUESTION 1 Compare and contrast spontaneous and induced


Question Description:

35

QUESTION 1 Compare and contrast spontaneous and induced mutations, and differentiate between physical and chemical mutagens. QUESTION 2 Use the base sequence to answer the following questions about mutations. TACACGATGGTTTTGAAGTTACGTATT A. Is the sequence above a single strand of DNA or RNA? Why? B. Using the sequence above, show the translation result if a mutation results in a C replacing T at base 12 from the left end of the sequence. Is this an example of silent, missense, or nonsense mutation?

Answer

35