Phylogeny Lab using MEGA software -I am having so much trouble


Question Description:

25

Phylogeny Lab using MEGA software -I am having so much trouble getting MEGA to work on my mac so help with these questions would be greatly appreciated. 1.) Upload the tree file you created in MEGA based on: “10 mammal cytb.meg” Please submit in .pdf format 2.) Upload the tree file you created in MEGA based on: “10 mammal RAG1.meg” Please submit in .pdf format 3.) Look at the two trees you created in MEGA for “10 mammal cytb.meg” and “10 mammal RAG1.meg”. Are the two trees different or the same? Explain your answer in terms of: a) primary/main branching pattern (1 mark) b) branching patterns of the Phoca genus (1 mark) c) branching patterns of Macaca mulatta (1 mark) 4.) Look at the two trees you created in MEGA for “10 mammal cytb.meg” and “10 mammal RAG1.meg”. Provide 3 main reasons why there may be differences between the two trees. (3 marks) 5.) Look at the two trees you created in MEGA for “10 mammal cytb.meg” and “10 mammal RAG1.meg”. a) Do boostrap values in the nuclear or mtDNA tree have better support for the branching pattern for Glaucomys volans. Provide boostrap values to support your answer (3 marks). b) In comparing the two trees, which species have 100% bootstrap support in both trees? (1 mark). 6.) a) Is the clustering of Hippopotamus amphibius consistent with the most recent literature (2009 or newer) (1 mark)? b) Provide a citation and a direct quote from that citation that supports your answer (2 marks). 7.) Upload the tree file you created in MEGA based on: “Tamarix.meg” Please submit your file in .pdf format 8.) Remember to upload the phylogenetic tree you created in MEGA for the file “Tamarix.meg”. This question refers to that tree. The Tamarix haplotypes upon which this tree is based were collected from the following locations: Haplotypes 1 –14: Europe Haplotypes 15 and 16: Northern Africa Haplotypes 17 –29: Asia Haplotypes 30 –32: United States (from invasive populations) a) Based on this information, and on the information that you get from the phylogenetic tree, what is the most likely source of the invasive Tamarix in the U.S? In other words, did the invaders most likely come from Europe, northern Africa, or Asia? (1 mark) b) Explain your answering in terms of branching pattern (1 mark) and boostrap support (1 mark). 9.) The sequence identified in the file “sequence (1).fasta” is from an American eel. True False 10.) What is the Accession number for the best match in Genbank (100% Query Coverage AND 100% Identity) for the sequence found in the file “sequence (1).fasta”? Please be precise in entering your answer. [x1] Attachment 1 Attachment 2 Attachment 3 Attachment 4 ATTACHMENT PREVIEW Download attachment 10 mammal cytb.meg #mega !Title mammal cytochrome b gene – mitochondrial; !Format DataType=DNA indel=- CodeTable=Standard; !Domain=Data property=Coding CodonStart=1; #AB510445_Phoca_largha_cytb "Phoca largha mitochondrial cytb gene for cytochrome b, complete cds, isolate: Pl23." ATGACCAACATCCGAAAAACCCATCCACTAATAAAAATTATCAACAACTCATTCATCGAC CTACCCACACCATCAAATATCTCAGCATGATGAAACTTTGGATCTCTTCTCGGAATCTGC CTAATCCTGCAGATCTTAACAGGCTTGTTCCTAGCCATACACTACACCTCAGACACAACC ACAGCCTTCTCATCAGTAACCCACATCTGCCGAGACGTAAACTACGGCTGAATCATCCGT TATCTTCACGCAAATGGAGCTTCCATATTTTTCATCTGCCTATACATGCATGTAGGACGA GGACTGTATTACGGCTCCTACACATTCACAGAGACATGAAACATCGGCATTATCCTCTTA TTCACCATCATAGCTACAGCATTCATGGGCTACGTCCTACCATGAGGACAAATATCATTT TGAGGAGCAACAGTCATTACCAATCTACTATCAGCAATCCCCTATATCGGAACCGACCTT GTACAATGAATCTGAGGAGGGTTTTCAGTAGATAAAGCAACCTTAACACGATTCTTCGCC TTCCACTTCATCCTACCATTCGTAGTATTAGCTCTAGCAGCAGTCCACCTACTATTCCTA CACGAAACAGGATCAAACAACCCCTCCGGAATCATATCCGACTCAGACAAAATCCCATTC CACCCGTACTATACAATTAAAGATATCCTAGGGGCCCTACTTCTCATTCTAGTCCTGACA CTACTAGTACTATTCTCACCCGACCTGTTAGGAGACCCCGACAACTATATCCCTGCCAAT CCCCTAAACACCCCACCACATATCAAACCCGAATGGTACTTCCTATTTGCCTACGCAATC TTACGATCCATCCCCAACAAACTAGGAGGAGTACTAGCCCTAGTACTCTCCATTCTTATC CTCGCTATCGTACCCCTACTCCACACGTCAAAACAACGAGGAATGATATTCCGGCCCATC AGCCAATGCCTATTCTGACTTCTAGTAGCAGACCTACTTACACTAACATGAAT

Answer

25