1. Name the scientist who founded Celera Corporation, became a


Question Description:

27.50

I attached a file with the questions just incase there is something confusing with what i posted1. Name the scientist who founded Celera Corporation, became a major player in getting the human genome sequenced, and was once a professor at UB. 2. What does the acronym ‘OMIM’ (as in OMIM Database) stand for and what information does it contain? 3. State as briefly as possible what is meant by ‘redundancy’ in the genetic code? 4. State as briefly as possible what is meant by ‘the genetic code is universal’? 5. List the codons that differ between the genetic code used for human mitochondrial DNA vs that used for human nuclear DNA. Include what each of these codons specify. 6. Below is an RNA sequence. Write a conceptual translation (using single letter amino acid abbreviations) above that might be encoded by this RNA. Mark any stop codon with an asterisk (*). AAGCAACAAUGCUUGAGACUAUUACGCUCAUAGAAUAAAGACUUAUGCAA 7. Below is a partial alignment of protein sequences of insulin from humans with insulin from dog. Identical amino acids are marked with an asterisk (*). Below the sequence is a list of the six amino acid substitutions in the human vs dog comparison. Consult the BLOSM62 Substitution Matrix and list behind each of these if these are conservative (C), semi-conservative (SC), or non-conservative amino acid replacements. human insulin EAEDLQVGQVELGGGPGAGS * ***** *** * ** * dog insulin EVEDLQVRDVELAGAPGEGG A → V G → R Q → D G → A A → E S → G 8. What amino acid is least likely to replaced by a different amino acid in similar proteins among species? Which amino acid is second least likely to be replaced. ATTACHMENT PREVIEW Download attachment 2016_bio130_lab03_assignment_sheet(1).doc 1. Name the scientist who founded Celera Corporation, became a major player in getting the human genome sequenced, and was once a professor at UB. 2. What does the acronym ‘OMIM’ (as in OMIM Database) stand for and what information does it contain? 3. State as briefly as possible what is meant by ‘redundancy’ in the genetic code? 4. State as briefly as possible what is meant by ‘the genetic code is universal’? 5. List the codons that differ between the genetic code used for human mitochondrial DNA vs that used for human nuclear DNA. Include what each of these codons specify. 6. Below is an RNA sequence. Write a conceptual translation (using single letter amino acid abbreviations) above that might be encoded by this RNA. Mark any stop codon with an asterisk (*). AAGCAACAAUGCUUGAGACUAUUACGCUCAUAGAAUAAAGACUUAUG CAA 7. Below is a partial alignment of protein sequences of insulin from humans with insulin from dog. Identical amino acids are marked with an asterisk (*). Below the sequence is a list of the six amino acid substitutions in the human vs dog comparison. Consult the BLOSM62 Substitution Matrix and list behind each of these if these are conservative (C), semi-conservative (SC), or non-conservative amino acid replacements. human insulin EAEDLQVGQVELGGGPGAGS * ***** *** * ** * dog insulin EVEDLQVRDVELAGAPGEGG A→V G→R Q→D G→A A→E S→G 8. What amino acid is least likely to replaced by a different amino acid in similar proteins among species? Which amino acid is second least likely to be replaced. Read more

Answer

27.50